Primer3 results

NumChromIdProduct startProduct endForward primer tempReverse primer tempPcrprod lengthAvg melt tempSequenceClamp pos
1 (view)1717_7578711_CTTT_C_25716475786897578728AGCGAGCTAGAGAGAGTTGG:58.611CAGAGCAAGACCCTATCTCA:56.0488064.127agcgagctagagagagttggCGTCTACACCTCAGGAGCTT
TTCTTTTTTTTTTTTTTTTTtgagatagggtcttgctctg
5-prime